Have you ever wondered why certain people have exhibited such violent, emotional reactions in opposition to the use of the anti-parasitic drugs ivermectin and hydroxychloroquine? I wonder...
I am seeing so many otherwise seemingly-good newsletter on Substack that offer you a rich discussion but then close you down when you try to add your own idea, as a 'Comment.'
I wonder: is closed commenting on paid articles the default setting on Substack?
And --well, kudos to this newsletter I suppose. He is not trying to shut me up at all.
When I read through the comments here, then you can really see how big the manipulation, the lies and the fraud as a psychological operation(s) has always been - and you James, are pushing THIS even further! Can you sink any lower...?!
Why in God's name are you writing about something you have absolutely no idea about!
This so-called “T. gondii” has NEVER been isolated before!!!
There is always a lot of BLA BLA BLA written to confuse people, and further down you can read the pseudo-scientific facts - but nobody gets as far as that....
We conducted PCR sequencing of 3 polymorphic genes, SAG3, GRA6 and GRA7, on all 31 isolates and clinical samples with previous successful nested PCR amplification of each marker (SAG3, n = 123; GRA6, n = 108; GRA7, n = 99) to provide sequence-based genotyping. Gene amplification of SAG3 and GRA6 resulted from the above-described Mn-PCR-RFLP method, and GRA7 amplifications were obtained by nested PCR using specific primer pairs [35]. PCR products were sent to the Center for Genomic Technologies of the Complutense University of Madrid (Spain) for direct sequencing. Briefly, amplicons were sequenced in both directions with the same internal primer pair used for amplification employing a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Carlsbad, CA, USA) and a 3730 × l DNA Sequence Analyser (Applied Biosystems). Sequencing was successful for 121 out of 123 SAG3-PCR positives, 77 out of 108 GRA6-PCR positives, and all 99 GRA7-PCR positives. The resulting sequences were imported, read, edited manually if necessary, and analysed using BioEdit software, version 7.0.5.3 [36]. Generated DNA consensus sequences were aligned to appropriate reference sequences using MEGA X software (http://www.megasoftware.net/) [37], and compared with sequences retrieved from the National Center for Biotechnology Information (NCBI) database through the BLAST tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi)."
And if you now click on ref. 35, you will see the following designed and artificial primer pairs:
TGTGCTCGTGACTTGATGTG
ACCAGAAAGCCAGTGGAATG
GGAAAACAAGCGGTGAGATT
TTTGTTTTTCTCGCGTAGAGG
CCAGCATGGATAAGGCATCT
GACGCTGAAGTGACTGACGA
GACACTGTCCTCGAGCTCCT
TTAGCCCCCATATCCTACTGG
And now you enter every single so-called "sequence" into the BLAST search
Check this yourself by entering these “letter groups” individually in each link (top left at Enter Query Sequence, then scroll down to the blue box on the left, click on it and wait) also in human, mouse, rat and the so-called non-existent “microbes” - and it doesn't matter how many so-called alignments a thermocycler makes and assembles with a software, it still ALWAYS remains a fraud/pseudoscience!!!!
All this shit (sorry, but enough is enough!) was and has already been based ALWAYS on a well-constructed pseudo-scientific and idiotic network that has absolutely NOTHING to do with reality!!!!
I am going to make this real simple for you....VIRUSES are an imaginary entity to explain poor health. They do not exist. They are very small particles visible in a high powered microscope and are likely the garbage the cells in your body are attempting to release. By "fighting viruses" we enrich the drug companies and ignore the real causes of our illnesses....dirty wells and contaminated drinking water, emf impacting our brains and organs, chemicalized and denatured food. alcoholism and drug addiction....These and other solvable problems can make us sick. But they won't make money for the drug dealers.
I'll tell you what to do: GET A COUNTERTOP DISTILLER for your drinking water and avoid sitting too long in baths or showers...your skin will absorb the fluoride and other crap. If you work at it you can find good sources of food...they won't be at publix though.... It's not impossible to eat good food. It does take a bit of planning....
Well... I know that, since I had earned my living for almost 40 years with these fraudulent experiments on so-called "microbes" in vitro and in silico, but thanks for your comment anyway!
I haven't looked at the videos yet, but the term 'bartonella rage' is bandied about the Lyme community often. Another infection then (bartonella) that has been blamed for anger outbursts. I get them myself and would be glad to have help. It seemes to me the medical community and public is so slow to accept that behavioural symptoms can occur when infections enter the brain and are ignorant / behind in bothering to treat these.
The parasitic mind control only comes from the bloodline humans who are already infected. They that are in leadership roles in government, military, hospital, education, banking, religion, race, gender, Hollywood, and in every country involving Brics and Nato. They lead humans to their death every day through indoctrination and education with media mind control. Consciousness is our ONLY salvation.
They are just idiots. Ignore them. You don't have to watch television or eat at Mcduckes...just get a good book and cook some rice and veggies. It's easy.
Behold, James Roguski’s own words regarding Ivermectin.
*
He can’t even a simple question:
Do you believe IVERMECTIN is safe and effective?!
*
See my earlier comments of today (I’ll post it in the comment section of this note) where I discovered that James Roguski used a bot to comment on my comment which then triggered me even more, thinking is James a Judas?
Is James part of the controlled opposition on Big Pharma’s payroll to play the “good guy” pushing you onto their other poison called IVERMECTIN.
*
Anyway, some part of me is still hoping James Roguski is really a good guy and he just didn’t do his homework on IVERMECTIN like he did on the mRNA injections.
*
James, I’m still eager to hear your answer, just a simple YES or NO will suffice, but somehow, I guess we both know where we stand…
*
Let God be our witness and judge,
And I truly hope you have the courage to tell the truth
and give me a straight answer!
Do you believe IVERMECTIN is safe and effective?! *
*
So far, see attached comment, this is James Roguski’s “answer”: “Ivermectin has its benefits, if used wisely. Used indiscriminately, it can certainly be misused.”
Also. The important thing is to not allow anybody but the Lord to be controlling our minds and hearts. If we have repented and believe on Him and know he saved us. Only way to be protected is to be reading the Holy Scriptures and praying and judging ourselves. 'Thou wilt keep in perfect peace the mind stayed on Thee.' That also will guide us in wise decisions as to our health.
Thats a good enough answer. I just keep studying it. You will have to make your own descision. You cannot demand someone else to. He hasnt lied. He has given an answer. Use Wormwood and Black Walnur instead if you are worried. Get Dr. MARKS book. See what he says. Take fenben instead if you are worried about Iverm.
When I was in upstate New York, I had parasites and heavy metal overload, including toxoplasmosis. Integrative medicine Dr gave me a detox by Metagenics. Very painful but very effective!
I have chronic inflammation response syndrome from mold and many autoimmune issues. When I had scabies, the doctors would look at me from across the room and say I was having a psoriasis flare. Finally a walk in clinic helped me, the regular doctor was absent and the man who filled in was from Africa and helped me immediately.
Months of suffering and getting gaslit and being a hazard to society myself was a mind bending experience.
Is James Roguski another CO agent of the so-called “Freedom movement”, another Big Pharma Industrial Complex Controlled Opposition programs.
I quote his Substack description:
“It is every person's responsibility to question their most cherished beliefs, challenge claims of authority and disobey unjust laws. That is how we grow while remaining free and maintaining our integrity.”
James, honestly, why do you need a bot called “Lori” (who only reads 3 and has only two subscribers) to comment on my comment?
BECAUSE, when I blocked Lori, to my surprise: your Substack picture came up and the bot is clearly linked to your account.
Hmmm, the plot thickens, don’t it?
So tell me James, who are you really?!
AND the question remains: Do you believe IVERMECTIN is safe and effective?!
It’s all fear mongering in the best edition possible.
We are told that we have millions of microorganisms within - all beyond our control. Some are supposedly beneficial. What about others? Nobody is talking about it in a balanced and reasonable way. You only get clickbaits.
Then, bum, parasites will control your mind.
They have already conquered your mind. The fact that you are reading, writing and talking about them is proof that your mind is already taken over by these parasites.
Don’t you have better subjects? Good family life, being kind to others, helping selflessly? Becoming more aware of own limitations? Expanding practical skills and life-supporting knowledge?
Aside from the above... why would you worry about microbes taking over your mind? What is so valuable in it? All patterned behaviours, trained and programmed mindless reactions to one-off stimuli, fight or flight conflicts, ancient hatred and hostility to anything that is new and anyone who is a stranger, you name it. Maybe these parasites will free you from these addictions, who knows.
That would be a joke of the century. Parasites clean up human minds, psychotherapy announced useless. Aggression disappearing big time. Crime rates going down like never before. Mainstream media closing down due to insufficient coverage of dramas and collapsing viewer base. The military refuse to use weapons and want to be of social service for free. Politicians giving up their jobs due to conscience emerging. What a chance.
I spent the afternoon listening to all the videos and reading all the studies. This supports my own work focused on intrapsychic predation. This weaves into so many aspects whose roots are ancient evolving through the kingdoms of nature to eventually heist the human mind. When I visited the Vatican in Rome there was a a large roman warrior bust that I quickly took a photo of that is slightly off, but very clear to see a giant worm with a face ripping through the warriors chest. I will text it to James and maybe he can post it. This also reminds me of the movie Matrix where the worm parasite was extracted through Neo's belly button that affects the gut microbiome and hence the brain via the gut-brain axis. Sad that cats have a bad rap with Toxo. Many ancient groups venerated cats and muslim countries do as well, Egyptians. Someone on FB reached out to me and I sent her studies on Toxo and Ivermectin for her cat. She needs to be careful of getting infected. Keep in mind that most of the so called diseases share a parasite connection and how Ivermectin is vilified because it works. I also noted the interchange of a virus to a parasite. So its seems that fungus, parasites and viruses share a connection. I would add in mold to affect the brain and personality. The social behavior of certain groups exhibits the predation, which is a disease of the mind. One third of the population is afflicted and with cats in so many households as a host to transfer toxo is a stealth predation through the kingdoms of nature. I see this as connecting into the vaxx which seems to now show in live blood parasites in semen, which links into transhumanism. To segue into this discussion I think needs a zoom connection as this all has chilling implications for human autonomy and the future of humanity. This is forever my hope as I connect this fully to Archons.
The Human Role in Gaia~Sophia’s Correction
When Pistis saw the impiety of the Lord Archon she was filled with anger. Acting in her invisible form, she spoke in this way: “You are mistaken, blind one ~ false deity who cannot see. There is an immortal luminous child, the Anthropos, who came into existence before you and who will appear among your spectral forms (plasmata). This luminous child will trample you in scorn just as a potter’s clay is pounded (into a lump). And you will sink away to your proper zone, the abyss (of gravity), along with those who belong to your legion. ” For at the consummation of your work, the entire defect [of Archontic illusion] exposed in the light of truth will be abolished, and [that illusion] will be as if it never had been.”
Thank you, James. I almost jumped on my chair because I have been screaming and writing about it for a few years now, and getting through a lot less than this topic's worth.
I made an entire permanent page on my Substack with the links to the articles I wrote about it. I believe that protozoan and other intracellular parasites are a cause of many issues that are ascribed to other factors. Or, to be more precise, they are a MAJOR co-factor, with toxins and EMFs being other co-factors. I also think that the toxicity of "vaccines" is greatly exacerbated by pre-existing parasitic and fungal infections, as well as biological contaminations in vials.
I have read so many of your articles as I receive Dr. Mercola blogs daily. Thank you for all your hard work, especially during the worst Covid times. You are a hero along with Drs. Kory, Marik, McCullough, Cole, Varone, Ardis, Stone and the list goes on. Your articles kept me going. Blessings always.
Parasitology is not taught in medical school - it is considered the arena of Tropical Medicine (not taught in medical school).environmental medicine, nutrition... nope - not taught in medical school.
I would always say, our horses get ivermectin once a month, what are we chopped liver?
BTW, Toxoplasmosis is a great example of how a parasite can get into your thoughts so you are abnormally attracted to cats. That is what they do to rodents who literally throw them selves at cats as the organism wants to be eaten by cats as it is part of its life cycle.
The word Lunacy comes from the fact that parasite often get very active on the full moon and increase aberrant symptoms and behaviors in its victims.
I am seeing so many otherwise seemingly-good newsletter on Substack that offer you a rich discussion but then close you down when you try to add your own idea, as a 'Comment.'
I wonder: is closed commenting on paid articles the default setting on Substack?
And --well, kudos to this newsletter I suppose. He is not trying to shut me up at all.
Execute klas Shawn and his family make them eat z bugs
James,
See: https://substack.com/@innerjourney101/note/c-103365705
#TruthAboutIVERMECTIN
James, why don't you watch/read this first: https://lionessofjudah.substack.com/cp/159709392
And then answer this simple question:
Do you believe IVERMECTIN is safe and effective?!
YES or NO
IF you are who you pretend to be, you'll do the research.
IF you are what I suspect you to be, you'll answer with one of your bots.
Remember, God is our witness, there's no hiding.
The truth always comes out!
Well, that was certainly an informative and clear warning.
I've used it on cows for decades. My bro a DVM. It's called The Get Well Shot.
Your vagueness puts your comment into the 'why take type to type' bit bucket.
When I read through the comments here, then you can really see how big the manipulation, the lies and the fraud as a psychological operation(s) has always been - and you James, are pushing THIS even further! Can you sink any lower...?!
https://maryann255.substack.com/p/cancer-is-not-a-parasitic-infection
https://maryann255.substack.com/p/should-people-also-be-informed-about
Why in God's name are you writing about something you have absolutely no idea about!
This so-called “T. gondii” has NEVER been isolated before!!!
There is always a lot of BLA BLA BLA written to confuse people, and further down you can read the pseudo-scientific facts - but nobody gets as far as that....
It's all absolute nonsense!!!
e.g. here:
https://parasitesandvectors.biomedcentral.com/articles/10.1186/s13071-020-04275-z
we can read:
"Multilocus sequence typing (MLST) analysis
We conducted PCR sequencing of 3 polymorphic genes, SAG3, GRA6 and GRA7, on all 31 isolates and clinical samples with previous successful nested PCR amplification of each marker (SAG3, n = 123; GRA6, n = 108; GRA7, n = 99) to provide sequence-based genotyping. Gene amplification of SAG3 and GRA6 resulted from the above-described Mn-PCR-RFLP method, and GRA7 amplifications were obtained by nested PCR using specific primer pairs [35]. PCR products were sent to the Center for Genomic Technologies of the Complutense University of Madrid (Spain) for direct sequencing. Briefly, amplicons were sequenced in both directions with the same internal primer pair used for amplification employing a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Carlsbad, CA, USA) and a 3730 × l DNA Sequence Analyser (Applied Biosystems). Sequencing was successful for 121 out of 123 SAG3-PCR positives, 77 out of 108 GRA6-PCR positives, and all 99 GRA7-PCR positives. The resulting sequences were imported, read, edited manually if necessary, and analysed using BioEdit software, version 7.0.5.3 [36]. Generated DNA consensus sequences were aligned to appropriate reference sequences using MEGA X software (http://www.megasoftware.net/) [37], and compared with sequences retrieved from the National Center for Biotechnology Information (NCBI) database through the BLAST tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi)."
And if you now click on ref. 35, you will see the following designed and artificial primer pairs:
TGTGCTCGTGACTTGATGTG
ACCAGAAAGCCAGTGGAATG
GGAAAACAAGCGGTGAGATT
TTTGTTTTTCTCGCGTAGAGG
CCAGCATGGATAAGGCATCT
GACGCTGAAGTGACTGACGA
GACACTGTCCTCGAGCTCCT
TTAGCCCCCATATCCTACTGG
And now you enter every single so-called "sequence" into the BLAST search
https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=OGP__9606__9558&LINK_LOC=blasthome
https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=OGP__10090__9559&LINK_LOC=blasthome
https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=OGP__10116__10621&LINK_LOC=blasthome
https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=MicrobialGenomes
Check this yourself by entering these “letter groups” individually in each link (top left at Enter Query Sequence, then scroll down to the blue box on the left, click on it and wait) also in human, mouse, rat and the so-called non-existent “microbes” - and it doesn't matter how many so-called alignments a thermocycler makes and assembles with a software, it still ALWAYS remains a fraud/pseudoscience!!!!
https://maryann255.substack.com/p/the-fraud-with-the-thermal-cyclers
https://maryann255.substack.com/p/lets-come-to-the-so-called-bacteria
All this shit (sorry, but enough is enough!) was and has already been based ALWAYS on a well-constructed pseudo-scientific and idiotic network that has absolutely NOTHING to do with reality!!!!
I am going to make this real simple for you....VIRUSES are an imaginary entity to explain poor health. They do not exist. They are very small particles visible in a high powered microscope and are likely the garbage the cells in your body are attempting to release. By "fighting viruses" we enrich the drug companies and ignore the real causes of our illnesses....dirty wells and contaminated drinking water, emf impacting our brains and organs, chemicalized and denatured food. alcoholism and drug addiction....These and other solvable problems can make us sick. But they won't make money for the drug dealers.
I'll tell you what to do: GET A COUNTERTOP DISTILLER for your drinking water and avoid sitting too long in baths or showers...your skin will absorb the fluoride and other crap. If you work at it you can find good sources of food...they won't be at publix though.... It's not impossible to eat good food. It does take a bit of planning....
Well... I know that, since I had earned my living for almost 40 years with these fraudulent experiments on so-called "microbes" in vitro and in silico, but thanks for your comment anyway!
I haven't looked at the videos yet, but the term 'bartonella rage' is bandied about the Lyme community often. Another infection then (bartonella) that has been blamed for anger outbursts. I get them myself and would be glad to have help. It seemes to me the medical community and public is so slow to accept that behavioural symptoms can occur when infections enter the brain and are ignorant / behind in bothering to treat these.
Claus Analswab should be hanging in a tree with all the others pushing this agenda.
The parasitic mind control only comes from the bloodline humans who are already infected. They that are in leadership roles in government, military, hospital, education, banking, religion, race, gender, Hollywood, and in every country involving Brics and Nato. They lead humans to their death every day through indoctrination and education with media mind control. Consciousness is our ONLY salvation.
They are just idiots. Ignore them. You don't have to watch television or eat at Mcduckes...just get a good book and cook some rice and veggies. It's easy.
https://substack.com/@innerjourney101/note/c-102747617
#TruthAboutIVERMECTIN
*
Behold, James Roguski’s own words regarding Ivermectin.
*
He can’t even a simple question:
Do you believe IVERMECTIN is safe and effective?!
*
See my earlier comments of today (I’ll post it in the comment section of this note) where I discovered that James Roguski used a bot to comment on my comment which then triggered me even more, thinking is James a Judas?
Is James part of the controlled opposition on Big Pharma’s payroll to play the “good guy” pushing you onto their other poison called IVERMECTIN.
*
Anyway, some part of me is still hoping James Roguski is really a good guy and he just didn’t do his homework on IVERMECTIN like he did on the mRNA injections.
*
James, I’m still eager to hear your answer, just a simple YES or NO will suffice, but somehow, I guess we both know where we stand…
*
Let God be our witness and judge,
And I truly hope you have the courage to tell the truth
and give me a straight answer!
Do you believe IVERMECTIN is safe and effective?! *
*
So far, see attached comment, this is James Roguski’s “answer”: “Ivermectin has its benefits, if used wisely. Used indiscriminately, it can certainly be misused.”
You are welcome to call me directly anytime. 310-619-3055
Follow-up note from: https://substack.com/@innerjourney101/note/c-102747617
#TruthAboutIVERMECTIN
James, why don't you watch/read this first: https://lionessofjudah.substack.com/cp/159709392
And then answer this simple question:
Do you believe IVERMECTIN is safe and effective?!
YES or NO
IF you are who you pretend to be, you'll do the research.
IF you are what I suspect you to be, you'll answer with one of your bots.
Remember, God is our witness, there's no hiding.
The truth always comes out!
Also. The important thing is to not allow anybody but the Lord to be controlling our minds and hearts. If we have repented and believe on Him and know he saved us. Only way to be protected is to be reading the Holy Scriptures and praying and judging ourselves. 'Thou wilt keep in perfect peace the mind stayed on Thee.' That also will guide us in wise decisions as to our health.
Thats a good enough answer. I just keep studying it. You will have to make your own descision. You cannot demand someone else to. He hasnt lied. He has given an answer. Use Wormwood and Black Walnur instead if you are worried. Get Dr. MARKS book. See what he says. Take fenben instead if you are worried about Iverm.
When I was in upstate New York, I had parasites and heavy metal overload, including toxoplasmosis. Integrative medicine Dr gave me a detox by Metagenics. Very painful but very effective!
I have chronic inflammation response syndrome from mold and many autoimmune issues. When I had scabies, the doctors would look at me from across the room and say I was having a psoriasis flare. Finally a walk in clinic helped me, the regular doctor was absent and the man who filled in was from Africa and helped me immediately.
Months of suffering and getting gaslit and being a hazard to society myself was a mind bending experience.
IMPORTANT NOTE: https://substack.com/@innerjourney101/note/c-102680021
#TruthAboutIVERMECTIN
Is James Roguski another CO agent of the so-called “Freedom movement”, another Big Pharma Industrial Complex Controlled Opposition programs.
I quote his Substack description:
“It is every person's responsibility to question their most cherished beliefs, challenge claims of authority and disobey unjust laws. That is how we grow while remaining free and maintaining our integrity.”
James, honestly, why do you need a bot called “Lori” (who only reads 3 and has only two subscribers) to comment on my comment?
BECAUSE, when I blocked Lori, to my surprise: your Substack picture came up and the bot is clearly linked to your account.
Hmmm, the plot thickens, don’t it?
So tell me James, who are you really?!
AND the question remains: Do you believe IVERMECTIN is safe and effective?!
See: https://substack.com/@innerjourney101/note/c-102676278
***
SOURCE Comment: https://substack.com/@innerjourney101/note/c-102680021
It’s all fear mongering in the best edition possible.
We are told that we have millions of microorganisms within - all beyond our control. Some are supposedly beneficial. What about others? Nobody is talking about it in a balanced and reasonable way. You only get clickbaits.
Then, bum, parasites will control your mind.
They have already conquered your mind. The fact that you are reading, writing and talking about them is proof that your mind is already taken over by these parasites.
Don’t you have better subjects? Good family life, being kind to others, helping selflessly? Becoming more aware of own limitations? Expanding practical skills and life-supporting knowledge?
Aside from the above... why would you worry about microbes taking over your mind? What is so valuable in it? All patterned behaviours, trained and programmed mindless reactions to one-off stimuli, fight or flight conflicts, ancient hatred and hostility to anything that is new and anyone who is a stranger, you name it. Maybe these parasites will free you from these addictions, who knows.
That would be a joke of the century. Parasites clean up human minds, psychotherapy announced useless. Aggression disappearing big time. Crime rates going down like never before. Mainstream media closing down due to insufficient coverage of dramas and collapsing viewer base. The military refuse to use weapons and want to be of social service for free. Politicians giving up their jobs due to conscience emerging. What a chance.
I spent the afternoon listening to all the videos and reading all the studies. This supports my own work focused on intrapsychic predation. This weaves into so many aspects whose roots are ancient evolving through the kingdoms of nature to eventually heist the human mind. When I visited the Vatican in Rome there was a a large roman warrior bust that I quickly took a photo of that is slightly off, but very clear to see a giant worm with a face ripping through the warriors chest. I will text it to James and maybe he can post it. This also reminds me of the movie Matrix where the worm parasite was extracted through Neo's belly button that affects the gut microbiome and hence the brain via the gut-brain axis. Sad that cats have a bad rap with Toxo. Many ancient groups venerated cats and muslim countries do as well, Egyptians. Someone on FB reached out to me and I sent her studies on Toxo and Ivermectin for her cat. She needs to be careful of getting infected. Keep in mind that most of the so called diseases share a parasite connection and how Ivermectin is vilified because it works. I also noted the interchange of a virus to a parasite. So its seems that fungus, parasites and viruses share a connection. I would add in mold to affect the brain and personality. The social behavior of certain groups exhibits the predation, which is a disease of the mind. One third of the population is afflicted and with cats in so many households as a host to transfer toxo is a stealth predation through the kingdoms of nature. I see this as connecting into the vaxx which seems to now show in live blood parasites in semen, which links into transhumanism. To segue into this discussion I think needs a zoom connection as this all has chilling implications for human autonomy and the future of humanity. This is forever my hope as I connect this fully to Archons.
The Human Role in Gaia~Sophia’s Correction
When Pistis saw the impiety of the Lord Archon she was filled with anger. Acting in her invisible form, she spoke in this way: “You are mistaken, blind one ~ false deity who cannot see. There is an immortal luminous child, the Anthropos, who came into existence before you and who will appear among your spectral forms (plasmata). This luminous child will trample you in scorn just as a potter’s clay is pounded (into a lump). And you will sink away to your proper zone, the abyss (of gravity), along with those who belong to your legion. ” For at the consummation of your work, the entire defect [of Archontic illusion] exposed in the light of truth will be abolished, and [that illusion] will be as if it never had been.”
~On the Origin of the World, 103.15-30
Text to 310-619-3055
Just seeing this. Will text you soon. Intrapsychic parasitism is real!
Thank you, James. I almost jumped on my chair because I have been screaming and writing about it for a few years now, and getting through a lot less than this topic's worth.
https://tessa.substack.com/p/parasites-and-philosophy-of-medicine
I made an entire permanent page on my Substack with the links to the articles I wrote about it. I believe that protozoan and other intracellular parasites are a cause of many issues that are ascribed to other factors. Or, to be more precise, they are a MAJOR co-factor, with toxins and EMFs being other co-factors. I also think that the toxicity of "vaccines" is greatly exacerbated by pre-existing parasitic and fungal infections, as well as biological contaminations in vials.
Here is a story I wrote for Dr. Mercola in 2022 that https://articles.mercola.com/sites/articles/archive/2022/08/04/mind-controlling-parasites.aspx
There is SO MUCH about this topic. I pray that more and more people pay attention to this.
Read your Mercola article-fascinating! TY for posting.
Thank you Lori! xo
I have read so many of your articles as I receive Dr. Mercola blogs daily. Thank you for all your hard work, especially during the worst Covid times. You are a hero along with Drs. Kory, Marik, McCullough, Cole, Varone, Ardis, Stone and the list goes on. Your articles kept me going. Blessings always.
Parasitology is not taught in medical school - it is considered the arena of Tropical Medicine (not taught in medical school).environmental medicine, nutrition... nope - not taught in medical school.
I would always say, our horses get ivermectin once a month, what are we chopped liver?
BTW, Toxoplasmosis is a great example of how a parasite can get into your thoughts so you are abnormally attracted to cats. That is what they do to rodents who literally throw them selves at cats as the organism wants to be eaten by cats as it is part of its life cycle.
The word Lunacy comes from the fact that parasite often get very active on the full moon and increase aberrant symptoms and behaviors in its victims.